After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human HMGB1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human HMGB1 Gene Plasmid Map
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2 and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis is present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal "necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. In addition, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.

  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
  • Images
    • Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.