Quick Order

Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HMGB1cDNA Clone Product Information
Gene_bank_ref_id:NM_002128.4
cDNA Size:648
cDNA Description:ORF Clone of Homo sapiens high-mobility group box 1 DNA.
Gene Synonym:HMG1, HMG3, SBP-1, DKFZp686A04236
Species:Human
Vector:pCMV/hygro-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 633T/C and 636 T/C do not cause any amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10326-ACG$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10326-ACR$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10326-ANG$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10326-ANR$325
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10326-CF$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10326-CH$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10326-CM$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10326-CY$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone)HG10326-M$95
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10326-M-H$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10326-NF$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10326-NH$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10326-NM$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10326-NY$295
Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10326-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2 and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis is present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal "necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. In addition, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.

References
  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.
  • Size / Price
    Catalog:HG10326-M-F
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human HMGB1 / HMG1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"