After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LEPRcDNA Clone Product Information
cDNA Size:3498
cDNA Description:ORF Clone of Homo sapiens leptin receptor, transcript variant 1 DNA.
Gene Synonym:OBR, CD295
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HA Vector Information
Vector Name pCMV/hygro-HA
Vector Size 5684bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Schematic of pCMV/hygro-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged on other vectors
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10322-ACG$575
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10322-ACR$575
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10322-CF$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10322-CH$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10322-CM$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10322-CY$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10322-M$145
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10322-M-N$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10322-NF$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10322-NH$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10322-NM$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10322-NY$545
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10322-UT$545
 Learn more about expression Vectors
IL-6 Family & Receptor Related Products
Product nameProduct name
Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinHuman Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman Leptin ProteinHuman IL11RA / IL11Rα Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman CNTFR / CNTFR-alpha Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Human CNTF Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinRat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Human LIF Protein (Fc Tag)Human LIF Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinMouse IL6RA / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human GM-CSF / CSF2 ProteinRat IL6 / Interleukin-6 ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Rat LIFR Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Cynomolgus / Rhesus IL6 / Interleukin-6 ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Human Interleukin-31 receptor A / IL31RA Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Canine IL11RA / IL-11RA / IL11Rα Protein

Leptin Receptor or CD295 belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Leptin Receptor/CD295 is a transmembrane catalytic receptors found on NPY/AgRP and alpha-MSH/CART neurons in hypothalamic nuclei. Leptin receptors (Ob-Rs) are coded for by one human gene that produces six different isoforms; Ob-Ra - Ob-Rf. Ob-Rs exist as constitutive dimers at physiological expression levels. Only the Ob-Rb isoform can transduce intracellular signals and does so through activation of the JAK2/STAT3, PI 3-K and MAPK signaling cascades. Activation of Ob-Rs mediates transcriptional regulation of the hypothalamic melanocortin pathway and downregulates endocannabinoid expression. Leptin acts via leptin receptors. Leptin resistance has been proposed as a pathophysiological mechanism of obesity. In obese individuals, Ob-Ra (which is involved in active transport of leptin across the blood-brain barrier) expression is downregulated and the individual may be unresponsive to leptin signals. Ob-R antagonists are of great interest in the development of pharmacological treatments for obesity. Mutations in Leptin Receptor/CD295 have been associated with obesity and pituitary dysfunction.

  • Heshka JT, et al. (2001) A role for dietary fat in leptin receptor, OB-Rb, function. Life Sci. 69 (9): 987-1003.
  • Chen H, et al (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell. 84 (3): 491-5.
  • Bjrbaek C, et al. (1998) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem. 272 (51): 32686-95.
  • Size / Price
    List Price: $545.00  (Save $0.00)
    Price:$545.00      [How to order]
    Availability5 business days
    • Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, HA-tagged
    Recently Viewed Items