Quick Order

Text Size:AAA

Human LEP R transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human LEPR cDNA Clone Product Information
RefSeq ORF Size:3498bp
cDNA Description:Full length Clone DNA of Homo sapiens leptin receptor, transcript variant 1.
Gene Synonym:OBR, CD295
Restriction Site:HindIII + XbaI (5.5kb + 3.5kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human LEPR Gene Plasmid Map
Human LEP R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin ProteinHuman LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Human IL11RA / IL11Rα Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Human CNTF Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat CNTFR / CNTFR-alpha Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat CNTF / Ciliary Neurotrophic Factor ProteinHuman G-CSFR / CD114 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Rhesus IL6 / Interleukin-6 ProteinHuman IL11 / Interleukin 11 / IL-11 ProteinHuman LIF Protein (His Tag)Human LIF Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinCanine IL11RA / IL-11RA / IL11Rα ProteinRat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Mouse LIF ProteinHuman Interleukin-31 receptor A / IL31RA Protein (His Tag)

Leptin Receptor or CD295 belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Leptin Receptor/CD295 is a transmembrane catalytic receptors found on NPY/AgRP and alpha-MSH/CART neurons in hypothalamic nuclei. Leptin receptors (Ob-Rs) are coded for by one human gene that produces six different isoforms; Ob-Ra - Ob-Rf. Ob-Rs exist as constitutive dimers at physiological expression levels. Only the Ob-Rb isoform can transduce intracellular signals and does so through activation of the JAK2/STAT3, PI 3-K and MAPK signaling cascades. Activation of Ob-Rs mediates transcriptional regulation of the hypothalamic melanocortin pathway and downregulates endocannabinoid expression. Leptin acts via leptin receptors. Leptin resistance has been proposed as a pathophysiological mechanism of obesity. In obese individuals, Ob-Ra (which is involved in active transport of leptin across the blood-brain barrier) expression is downregulated and the individual may be unresponsive to leptin signals. Ob-R antagonists are of great interest in the development of pharmacological treatments for obesity. Mutations in Leptin Receptor/CD295 have been associated with obesity and pituitary dysfunction.

  • Heshka JT, et al. (2001) A role for dietary fat in leptin receptor, OB-Rb, function. Life Sci. 69 (9): 987-1003.
  • Chen H, et al (1996) Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell. 84 (3): 491-5.
  • Bjrbaek C, et al. (1998) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem. 272 (51): 32686-95.
  • Size / Price
    Catalog: HG10322-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions