Quick Order

Human SerpinA1 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SerpinA1 cDNA Clone Product Information
RefSeq ORF Size:1257bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1, transcript variant 1.
Gene Synonym:PI, A1A, AAT, PI1, A1AT, MGC9222, PRO2275, MGC23330
Restriction Site:HindIII + XbaI (5.5kb + 1.26kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SerpinA1 Gene Plasmid Map
Human SerpinA1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

SerpinA1, also known as Alpha-1 antitrypsin (AAT), is a prototype member of the Serpin superfamily of the serine protease inhibitors. This serine protease inhibitor blocks the protease, neutrophil elastase. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. SerpinA1 (alpha1-antitrypsin), an acute phase protein and the classical neutrophil elastase inhibitor, is localized within lipid rafts in primary human monocytes in vitro. It association with monocytes is inhibited by cholesterol depleting/efflux-stimulating agents (nystatin, filipin, MbetaCD (methyl-beta-cyclodextrin) and oxidized low-density lipoprotein (oxLDL) and conversely, enhanced by free cholesterol. Furthermore, SerpinA1/monocyte association per se depletes lipid raft cholesterol as characterized by the activation of extracellular signal-regulated kinase 2, formation of cytosolic lipid droplets, and a complete inhibition of oxLDL uptake by monocytes. Previous population studies have suggested that heterozygote status for the AAT gene (SerpinA1) is a risk factor for chronic rhinosinusitis with nasal polyposis (CRSwNP). Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SerpinA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin deficiency is an inherited disease affecting the lung and liver. In the liver, alpha-1 antitrypsin deficiency may manifest as benign neonatal hepatitis syndrome; a small percentage of adults develop liver fibrosis, with progression to cirrhosis and hepatocellular carcinoma. Its most important physiologic functions are the protection of pulmonary tissue from aggressive proteolytic enzymes and regulation of pulmonary immune processes.

  • Khnlein T, et al. (2008) Alpha-1 antitrypsin deficiency: pathogenesis, clinical presentation, diagnosis, and treatment. Am J Med. 121(1): 3-9.
  • Camelier AA, et al. (2008) Alpha-1 antitrypsin deficiency: diagnosis and treatment. J Bras Pneumol. 34(7): 514-27.
  • Subramaniyam D, et al. (2010) Cholesterol rich lipid raft microdomains are gateway for acute phase protein, SERPINA1. Int J Biochem Cell Biol. 42(9): 1562-70.
  • Kilty SJ, et al. (2010) Polymorphisms in the SERPINA1 (Alpha-1-Antitrypsin) gene are associated with severe chronic rhinosinusitis unresponsive to medical therapy. Am J Rhinol Allergy. 24(1): e4-9.
  • Size / Price
    Catalog: HG10306-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions