Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTPN1 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human PTPN1 Gene Plasmid Map
Human PTP1B / PTPN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

PTP1B, also known as PTPN1, belongs to the protein-tyrosine phosphatase (PTP) family. PTPs catalyze the hydrolysis of the phosphate monoesters specifically on tyrosine residues. Members of the PTP family share a highly conserved catalytic motif, which is essential for the catalytic activity. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. PTP1B contains 1 tyrosine-protein phosphatase domain and is expressed in many tissues. PTP1B is localized to the cytoplasmic face of the endoplasmic reticulum. PTP1B was also reported to dephosphorylate epidermal growth factor receptor kinase, as well as JAK2 and TYK2 kinases, which implicated the role of PTP1B in cell growth control, and cell response to IFN stimulation.

  • Frangioni JV, et al. (1992) The nontransmembrane tyrosine phosphatase PTP-1B localizes to the endoplasmic reticulum via its 35 amino acid C-terminal sequence. Cell. 68(3):545-60.
  • Zhu S, et al. (2007) PTP1B contributes to the oncogenic properties of colon cancer cells through Src activation. Cancer Res. 67(21):10129-37.
  • Aoki N, et al. (2000) A cytosolic protein-tyrosine phosphatase PTP1B specifically dephosphorylates and deactivates prolactin-activated STAT5a and STAT5b. J Biol Chem. 275(50):39718-26.
  • Stuible M, et al. (2008) PTP1B regulates cortactin tyrosine phosphorylation by targeting Tyr446. J Biol Chem. 283(23):15740-6.
  • Images
    • Human PTP1B / PTPN1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items