Quick Order

Human PODN / Podocan natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Podocan cDNA Clone Product Information
RefSeq ORF Size:1986bp
cDNA Description:Full length Clone DNA of Homo sapiens podocan.
Gene Synonym:PCAN, SLRR5A, MGC24995
Restriction Site:KpnI + XhoI (5.5kb + 1.99kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1401G/A not causing any amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Podocan Gene Plasmid Map
Human PODN / Podocan Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10303-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions