Quick Order

Text Size:AAA

Human Galectin-8 transcript variant 1 ORF mammalian expression plasmid, His tag

DatasheetReviewsRelated ProductsProtocols
Human Galectin-8/LGALS8 cDNA Clone Product Information
NCBI RefSeq:AF074000.1
RefSeq ORF Size:951bp
cDNA Description:Full length Clone DNA of Homo sapiens lectin, galactoside-binding, soluble, 8, transcript variant 1 with His tag.
Gene Synonym:Gal-8, PCTA1, PCTA-1, Po66-CBP
Restriction Site:KpnI + XhoI (5.5kb + 0.98kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Galectin-8/LGALS8 Gene Plasmid Map
Human Galectin-8 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • Size / Price
    Catalog: HG10301-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.