Quick Order

Human OSF2 / POSTN transcript variant 4 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human POSTN cDNA Clone Product Information
RefSeq ORF Size:2256bp
cDNA Description:Full length Clone DNA of Homo sapiens periostin, osteoblast specific factor, transcript variant 4 with Flag tag.
Gene Synonym:Pn, OSF-2, PDLPOSTN, MGC119510, MGC119511, periostin, RP11-412K4.1
Restriction Site:HindIII + XhoI (5.5kb + 2.29kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human POSTN Gene Plasmid Map
Human OSF2 / POSTN transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Periostin ( POSTN ), also known as OSF2 (osteoblast specific factor 2), is a heterofunctional secreted extracellular matrix (ECM) protein comprised of four fasciclin domains that promotes cellular adhesion and movement, as well as collagen fibrillogenesis. Postn is expressed in unique growth centers during embryonic development where it facilitates epithelial-mesenchymal transition (EMT) of select cell populations undergoing reorganization. In the adult, Postn expression is specifically induced in areas of tissue injury or areas with ongoing cellular re-organization. In the adult heart Postn is induced in the ventricles following myocardial infarction, pressure overload stimulation, or generalized cardiomyopathy. Although the detailed function of Postn is still unclear, Postn-integrin interaction is thought to be involved in tumor development. Postn is frequently overexpressed in various types of human cancers, stimulating metastatic growth by promoting cancer cell survival, invasion and angiogenesis, and can be a useful marker to predict the behavior of cancer.

  • Kudo,Y. et al., 2007, Histol Histopathol. 22 (10):1167-1174.
  • Li, J.S. et al., 2007, World J Gastroenterol. 13 (39): 5261-5266.
  • Oku, E. et al., 2008, Int J Hematol. 88 (1): 57-63.
  • Hamilton, D.W. et al., 2008, J Cell Commun Signal. 2(1-2):9-17.
  • Puglisi, F.J et al., 2008, Clin Pathol. 61 (4): 494-498.
  • Conway, S. J. et al., 2008, Curr Genomics. 9 (8): 548-555.