Quick Order

Human Matriptase / ST14 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Matriptase/ST14 cDNA Clone Product Information
Gene_bank_ref_id:NM_021978.3
RefSeq ORF Size:2568bp
cDNA Description:Full length Clone DNA of Homo sapiens suppression of tumorigenicity 14 (colon carcinoma).
Gene Synonym:HAI, MT-SP1, MTSP-1, MTSP1, PRSS14, SNC19, TADG-15
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-ST14
Restriction Site:KpnI + XhoI (5.5kb + 2.57kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 1215C/T mutation not causing amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Matriptase/ST14 Gene Plasmid Map
Human Matriptase / ST14 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"