Quick Order

Human MMP-12 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MMP-12cDNA Clone Product Information
cDNA Size:1413
cDNA Description:ORF Clone of Homo sapiens matrix metallopeptidase 12 (macrophage elastase) DNA.
Gene Synonym:MMP12, HME, MME, MGC138506
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 519 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Macrophage metalloelastase, also known as Matrix metalloproteinase-12, Macrophage elastase, MMP12, and MMP-12, is a secreted protein which belongs to the peptidase M10A family. MMP12 is a macrophage-secreted elastase that is highly induced in the liver and lung in response to S. mansoni eggs and contains four hemopexin-like domains. MMP12 is a proteolytic enzyme responsible for cleavage of plasminogen to angiotensin, which has an angiostatic effect. It may be involved in tissue injury and remodeling and has significant elastolytic activity. It may be related to prognosis in breast cancer patients. MMP12 promotes fibrosis by limiting the expression of specific ECM-degrading MMPs. Like MMP12, MMP13 expression is highly dependent on IL-13 and type I I-IL-4 receptor signaling. MMP12 is a potent proinflammatory and oncogenic molecule. MMP12 up-regulation plays a critical role in emphysema to lung cancer transition that is facilitated by inflammation.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human MMP-12 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Recently Viewed Items