Quick Order

Human MDK / NEGF2 transcript variant 2 ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MDK/NEGF2 cDNA Clone Product Information
RefSeq ORF Size:432bp
cDNA Description:Full length Clone DNA of Homo sapiens midkine (neurite growth-promoting factor 2), transcript variant 2 with His tag.
Gene Synonym:MDK, MK, NEGF2, FLJ27379
Restriction Site:HindIII + XhoI (5.5kb + 0.46kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase, and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as breast carcinomas marker.

  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Size / Price
    Catalog: HG10247-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions