Quick Order

Human MDK / NEGF2 transcript variant 2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MDK/NEGF2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human MDK/NEGF2 Gene Plasmid Map
Human MDK / NEGF2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase, and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as breast carcinomas marker.

  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.