After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human LDLR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LDLRcDNA Clone Product Information
cDNA Size:2583
cDNA Description:ORF Clone of Homo sapiens low density lipoprotein receptor DNA.
Gene Synonym:FH, FHC
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 1413 A/G and 1617 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

LDL Receptor, also known as LDLR, is a mosaic protein which belongs to the Low density lipoprotein receptor gene family. The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. LDL Receptor consists of 840 amino acids (after removal of signal peptide) and mediates the endocytosis of cholesterol-rich LDL. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. LDL Receptor is a cell-surface receptor that recognizes the apoprotein B100 which is embedded in the phospholipid outer layer of LDL particles. The receptor also recognizes the apoE protein found in chylomicron remnants and VLDL remnants.

  • Yamamoto T, et al. (1984) The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell. 39(1): 27-38.
  • Mao B, et al. (2001) LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature. 411(6835): 321-5.
  • Pinson KI, et al. (2000) An LDL-receptor-related protein mediates Wnt signalling in mice. Nature. 407(6803): 535-8.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability5 business days
    • Human LDLR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    • Human LDLR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items