Quick Order

Human C1s transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human C1s cDNA Clone Product Information
NCBI RefSeq:NM_001734.3
RefSeq ORF Size:2067bp
cDNA Description:Full length Clone DNA of Homo sapiens complement component 1, s subcomponent, transcript variant 1.
Gene Synonym:C1S, FLJ44757
Restriction Site:KpnI + XhoI (5.5kb + 2.07kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human C1s Gene Plasmid Map
Human C1s transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Complement is an integral component of the adaptive and innate immune systems and represents one of the major effector systems for the immune responses. The classical complement pathway is triggered by C1, a complex composed of the binding protein C1q and two proenzymes, C1r and C1s. Upon binding of IgG to the head of C1q, C1r undergoes autoactivation and in turn cleaves and activates C1s. C1r and C1s, the proteases responsible for activation and proteolytic activity of the C1 complex of complement, share similar overall structural organizations featuring five nonenzymic protein modules (two CUB modules surrounding a single EGF module, and a pair of CCP modules) followed by a serine protease domain. Besides highly specific proteolytic activities, both proteases exhibit interaction properties associated with their N-terminal regions. In contrast, C1r and C1s widely differ from each other by their glycosylation patterns: both proteins contain Asn-linked carbohydrates, but four glycosylation sites are present on C1r, and only two on C1s. As a highly specific serine protease, C1s executes the catalytic function of the C1 complex: the cleavage of C4 and C2, and thus instigates a sequence of activation steps of other components of the complement system, culminating in the formation of the membrane attack complex which induces cell lysis. Like other complement serine proteases C1s has restricted substrate specificity and it is engaged into specific interactions with other subcomponents of the complement system. The only other protein known to interact with C1s physiologically is SerpinC1, an inhibitor of serine protease, which inhibits C1s activity and thus plays a regulatory role in controlling the function of C1s enzyme.

  • Arlaud GJ, et al. (1989) Structure and function of C1r and C1s: current concepts. Behring Inst Mitt. (84): 56-64.
  • Thielens NM, et al. (1999) Structure and functions of the interaction domains of C1r and C1s: keystones of the architecture of the C1 complex. Immunopharmacology. 42(1-3): 3-13.
  • Gl P, et al. (2002) C1s, the protease messenger of C1. Structure, function and physiological significance. Immunobiology. 205(4-5): 383-94.
  • Size / Price
    Catalog: HG10220-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.