After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD95cDNA Clone Product Information
cDNA Size:1008
cDNA Description:ORF Clone of Homo sapiens Fas (TNF receptor superfamily, member 6), transcript variant 1 DNA.
Gene Synonym:FAS, APT1, CD95, FAS1, APO-1, FASTM, ALPS1A, TNFRSF6
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 642 T/C not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged on other vectors
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10217-ACG$325
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10217-ACR$325
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10217-CF$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10217-CH$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10217-CM$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10217-CY$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10217-M$95
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10217-M-F$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10217-M-N$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10217-NF$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10217-NH$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10217-NM$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10217-NY$295
Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10217-UT$295
 Learn more about expression Vectors
Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinHuman DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinHuman XEDAR / EDA2R Protein (His Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Ferret TNF-alpha / TNFA ProteinCanine TNF-alpha / TNFA / TNFSF1A ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinRat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinCynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinCynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human TNFRSF11A Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)

CD95 (APO-1/Fas) is an important inducer of the extrinsic apoptosis signaling pathway and therapy induced apoptosis of many tumor cells has been linked to the activity of CD95. is a prototype death receptor characterized by the presence of an 80 amino acid death domain in its cytoplasmic tail. This domain is essential for the recruitment of a number of signaling components upon activation by either agonistic anti-CD95 antibodies or cognate CD95 ligand that initiate apoptosis. The complex of proteins that forms upon triggering of CD95 is called the death-inducting signaling complex (DISC). The DISC consists of an adaptor protein and initiator caspases and is essential for induction of apoptosis. CD95 is also crucial for the negative selection of B cells within the germinal center (GC). Impairment of CD95-mediated apoptosis results in defective affinity maturation and the persistence of autoreactive B-cell clones. Changes in the expression of CD95 and/or its ligand CD95L are frequently found in human cancer. The downregulation or mutation of CD95 has been proposed as a mechanism by which cancer cells avoid destruction by the immune system through reduced apoptosis sensitivity. Thus, CD95 has therefore been viewed as a tumor suppressor. CD95 has been reported to be involved in the activation of NF-kappaB, MAPK3/ERK1, MAPK8/JNK, and the alternate pathways for CTL-mediated cytotoxicity. Accordingly, this protein is implicated in the pathogenesis of various malignancies and diseases of the immune system. The CD95/CD95L system was implicated in the etiology of inflammatory bowel disease (IBD) based, primarily, on the finding that CD95 is highly expressed in the intestinal epithelial cells and that epithelial apoptosis is increased in IBD.

  • Mschen M, et al. (2002) The origin of CD95-gene mutations in B-cell lymphoma. Trends Immunol. 23(2): 75-80.
  • Peter ME, et al. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 10(1): 26-35.
  • Peter ME, et al. (2005) Does CD95 have tumor promoting activities Biochim Biophys Acta. 1755(1): 25-36.
  • Chen L, et al. (2010) Cell death in the colonic epithelium during inflammatory bowel diseases: CD95/Fas and beyond. Inflamm Bowel Dis. 16(6): 1071-6.
  • Size / Price
    List Price: $345.00  (Save $50.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CD95 / Fas transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items