Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD209/DC-SIGN cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3) grabbing nonintegrin (DC-SIGN), also known as CD209, is a type II transmembrane protein on DCs with a C-type lectin extracellular domain, is capable of binding ICAM-3 on resting T cells in the secondary lymphoid organs, providing the initial contact between these cells during the establishment of cell-mediated immunity. It is not only a pattern recognition receptor but implicated in immunoregulation of DCs. It has important role in mediating DC adhesion, migration, inflammation, activating primary T cell, triggering immune response and participating in immune escape of pathogens and tumors. DC-SIGN also mediates capture and internalization of viral, bacterial, and fungal pathogens by dendritic cells, such as HIV-1, Ebola virus, cytomegalovirus, Dengue virus, and hepatitis C virus. DC-SIGN is unique in that it regulates adhesion processes, such as DC trafficking and T-cell synapse formation, as well as antigen capture. Moreover, even though several C-type lectins have been shown to bind HIV-1, DC-SIGN does not only capture HIV-1 but also protects it in early endosomes allowing HIV-1 transport by DC to lymphoid tissues, where it enhances trans infection of T cells.

  • Geijtenbeek TB, et al. (2002) DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. J Leukoc Biol. 71(6): 921-31.
  • Masso M. (2003) DC-SIGN points the way to a novel mechanism for HIV-1 transmission. MedGenMed. 5(2): 2.
  • Zhou T, et al. (2006) DC-SIGN and immunoregulation. Cell Mol Immunol. 3(4): 279-83.
  • Images
    • Human CD209 / DC-SIGN Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items