After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Bcl-2/BCL2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human Bcl-2/BCL2 Gene Plasmid Map
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Images
    • Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items