Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EphrinA5/EFNA5 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human EphrinA5/EFNA5 Gene Plasmid Map
Human EphrinA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Mouse EphA3 Protein (aa 569-984)Rat EphA3 Protein (Fc Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB2 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA4 Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinHuman EphB1 / EPHT2 Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (His Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Rat EphA3 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EphA4 Protein (Fc Tag)Rhesus Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Human EphA3 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Human EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Human EphA2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinRhesus EphB1 / EPHT2 Protein (Fc Tag)Mouse EphA3 Protein (aa 569-984, His & GST Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Mouse EphA3 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)

Ephrin-A5 also known as EFNA5, is a member of the Ephrin family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. Ephrin-A5/EFNA5 may function actively to stimulate axon fasciculation. The interaction of EFNA5 with EPHA5 also mediates communication between pancreatic islet cells to regulate glucose-stimulated insulin secretion. Ephrin-A5/EFNA5 also serves as a cognate/functional ligand for EPHA7, their interaction regulates brain development modulating cell-cell adhesion and repulsion.

  • Frisén J, et al. (1998) Ephrin-A5 (AL-1/RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system. Neuron. 20(2): 235-43.
  • Feldheim DA, et al. (2000) Genetic analysis of ephrin-A2 and ephrin-A5 shows their requirement in multiple aspects of retinocollicular mapping. Neuron. 25(3): 563-74.
  • Wahl S, et al. (2000) Ephrin-A5 induces collapse of growth cones by activating Rho and Rho kinase. J Cell Biol. 149(2): 263-70.
  • Images
    • Human EphrinA5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items