Quick Order

Human CNTN4 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CNTN4 cDNA Clone Product Information
RefSeq ORF Size:3081bp
cDNA Description:Full length Clone DNA of Homo sapiens contactin 4, transcript variant 1.
Gene Synonym:CNTN4, AXCAM, BIG-2, SCA16, CNTN4A, MGC33615
Restriction Site:BamHI + XhoI (5.5kb + 3.08kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for five point mutations : 1551A/G, 1554G/A, 1869C/T, 1911A/G, 2268 T/C, yet none of which results in the encoded amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high expression in testes, thyroid, small intestine, uterus and brain. This protein is an neuronal membrane protein that functions as an glycosylphosphatidylinositol- anchored cell adhesion molecule. Contactin-4 is considered as a candidate protein responsible for the differentiation potential of human neuroblastoma cells and it has been implicated in some cases of autism and spinocerebellar ataxia type 16. Studies of the cantactin family have revealed a complex pattern of hemophilic and heterophilic interactions that are required for axon growth and pathfinding. Such studies demonstrate that these essential functions are mediated by the combination and juxtaposition of multiple Ig and FNIII domains. Second, these neuronal adhesion molecules demonstrate highly regulated temporal and spatial expression patterns in the CNS. For this reason, the disruption of the regulatory region of the predominant brain-expressed isoform reasonable would be expected to have significant functional consequences. 

  • Zeng L, et al. (2002) A novel splice variant of the cell adhesion molecule contactin 4 ( CNTN4) is mainly expressed in human brain. J Hum Genet. 47 (9): 497-9.
  • Thomas Fernandez, et al. (2004) Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome. Am J Hum Genet. 74 (6): 1286-93.
  • Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.
  • Size / Price
    Catalog: HG10178-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions