After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD25 / IL2Rα ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD25/IL2Ra cDNA Clone Product Information
RefSeq ORF Size:819bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 2 receptor, alpha (IL2RA) with His tag.
Gene Synonym:IL2RA, CD25, IL2R, TCGFR, IDDM10
Restriction Site:KpnI + XhoI (5.5kb + 0.85kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 516 C/T point mutation not causing any amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Rhesus CD122 / IL-2RB Protein (Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Rhesus CD122 / IL-2RB Protein (His Tag)Mouse IL7 / Interleukin 7 ProteinMouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-21 / IL-21 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Rat IL9R / Interleukin 9 receptor Protein (His Tag)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinMouse IL21 / Interleukin 21 ProteinCanine IL21 / Interleukin 21 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag)Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Human IL7 / interleukin 7 ProteinRat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Rhesus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL21 / Interleukin 21 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Rat IL7 / interleukin 7 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-15 / IL15 / Interleukin 15 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)

CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.

  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.
  • Size / Price
    Catalog: HG10165-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions