Quick Order

Text Size:AAA

Human CCL22 / MDC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CCL22/MDCcDNA Clone Product Information
Gene_bank_ref_id:NM_002990.3
cDNA Size:282
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 22 DNA.
Gene Synonym:CCL22, MDC, ABCD-1, SCYA22, STCP-1, DC/B-CK, MGC34554, A-152E5.1
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Chemokine & Receptor Related Products
Product nameProduct name
Background

Chemokine (C-C motif) ligand 22(ABCD-1 / CCL22)is a kind of CC chemokine which is a family of secreted proteins involved in immunoregulatory and inflammatory processes. The cytokine displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. This ABCD-1 / CCL22 chemokine binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated / effector T lymphocytes to inflammatory sites and other aspects of activated T-lymphocyte physiology. ABCD-1 / CCL22 is highly expressed in macrophage and in monocyte-derived dendritic cells, and thymus, and in Langerhans' cell histiocytosis and atopic dermatitis but not in dermatopathic lymphadenopathy. This chemokine is also found in lymph node, appendix, activated monocytes, resting and activated macrophages. This protein is lower expressed in lung and spleen and very weekly expressed in small intestine.

References
  • Vulcano M, et al. (2001) Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo. Eur J Immunol. 31(3): 812-22.
  • Kwon DJ, et al. (2011) Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-?B and STAT1 activation in HaCaT cells. Biochem Biophys Res Commun. 417(4):1254-9.
  • Hirota T, et al. (2011) Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies. PLoS One. 6(11):e26987.
  •  

    CCL22/MDC related areas, pathways, and other information

    Size / Price
    Catalog:HG10163-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human CCL22 / MDC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"