After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CCL22 / MDC ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL22/MDC cDNA Clone Product Information
NCBI RefSeq:NM_002990.3
RefSeq ORF Size:282bp
cDNA Description:Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 22 with Flag tag.
Gene Synonym:CCL22, MDC, ABCD-1, SCYA22, STCP-1, DC/B-CK, MGC34554, A-152E5.1
Restriction Site:KpnI + XhoI (5.4kb + 0.33kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CCL22/MDC Gene Plasmid Map
Human CCL22 / MDC Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Chemokine (C-C motif) ligand 22(ABCD-1 / CCL22)is a kind of CC chemokine which is a family of secreted proteins involved in immunoregulatory and inflammatory processes. The cytokine displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. This ABCD-1 / CCL22 chemokine binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated / effector T lymphocytes to inflammatory sites and other aspects of activated T-lymphocyte physiology. ABCD-1 / CCL22 is highly expressed in macrophage and in monocyte-derived dendritic cells, and thymus, and in Langerhans' cell histiocytosis and atopic dermatitis but not in dermatopathic lymphadenopathy. This chemokine is also found in lymph node, appendix, activated monocytes, resting and activated macrophages. This protein is lower expressed in lung and spleen and very weekly expressed in small intestine.

  • Vulcano M, et al. (2001) Dendritic cells as a major source of macrophage-derived chemokine/CCL22 in vitro and in vivo. Eur J Immunol. 31(3): 812-22.
  • Kwon DJ, et al. (2011) Casuarinin suppresses TARC/CCL17 and MDC/CCL22 production via blockade of NF-?B and STAT1 activation in HaCaT cells. Biochem Biophys Res Commun. 417(4):1254-9.
  • Hirota T, et al. (2011) Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies. PLoS One. 6(11):e26987.

    CCL22/MDC related areas, pathways, and other information

    Size / Price
    Catalog: HG10163-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.