After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CHL-1 Gene cDNA clone plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CHL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_006614.2
RefSeq ORF Size:3675bp
cDNA Description:Full length Clone DNA of Homo sapiens RAB5A, member RAS oncogene family.
Gene Synonym:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
Species:Human
Vector:Vector 3
Plasmid:pcDNA3-CHL1
Restriction Site:HindIII + XhoI (5.4kb + 3.38kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 3213T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Vector 3 Information

The Vector 3 is 5.4kb in length, and contains the the amplicin resistance gene, conferring selection of the plasmid in E. coli., the kanamycin resistance gene (neomycin for mammalian selection), and the CMV promoter upstream of the cDNA insert. The SV40 origin allows for replication in mammalian cells, the ColE1 origin is the bacterial origin of replication, and the f1 origin is the filamentous phage origin of replication. The plasmid has multiple cloning sites as shown below. NOTE: the restriction enzymes used in each vector 3 clone is indicated in the product datasheet.

Vector 3 Usage Suggestion

The coding sequence can be easily obtained by digesting the vector with proper restriction enzyme(s). The coding sequence can also be amplified by PCR with primer pair SP6 and T7.

Vector Sequence Download
Product nameProduct name
Background

Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

References
  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.
  • Size / Price
    Catalog: HG10143-C
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"