After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RB1/OSRCcDNA Clone Product Information
Gene_bank_ref_id:NM_000321.2
cDNA Size:2787
cDNA Description:ORF Clone of Homo sapiens retinoblastoma 1 DNA.
Gene Synonym:RB, pRb, OSRC, pp110, p105-Rb
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10137-ACG$425
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10137-ACR$425
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10137-ANG$425
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10137-ANR$425
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10137-CF$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10137-CH$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10137-CM$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10137-CY$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone)HG10137-M$145
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10137-M-F$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10137-NF$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10137-NH$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10137-NM$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10137-NY$395
Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10137-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10137-M-N
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability5 business days
Images
  • Human RB1 / OSRC Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"