After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CCL2 / MCP-1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CCL2/MCP-1 cDNA Clone Product Information
Gene_bank_ref_id:NM_002982.3
RefSeq ORF Size:299
cDNA Description:ORF Clone of Homo sapiens chemokine (C-C motif) ligand 2 DNA.
Gene Synonym:HC11, MCAF, MCP1, MCP-1, SCYA2, GDCF-2, SMC-CF, HSMCR30, MGC9434
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XbaI
Tag Sequence:
Sequence Description:Same as Gene Bank Ref. ID sequence with the nucleotide 10T deletion mutation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Size / Price
Catalog: HG10134-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"