Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MEP1A cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I  membrane protein which belongs to the peptidase M12A family. MEP1A contains one EGF-like domain, one MAM domain, and one MATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).

  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
  • Images
    • Human MEP1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items