After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PCSK1 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PCSK1 cDNA Clone Product Information
RefSeq ORF Size:2262bp
cDNA Description:Full length Clone DNA of Homo sapiens proprotein convertase subtilisin/kexin type 1 with Flag tag.
Gene Synonym:PC1, PC3, NEC1, SPC3, BMIQ12, PCSK1
Restriction Site:KpnI + XhoI (5.5kb + 2.29kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PCSK1 Gene Plasmid Map
Human PCSK1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Neuroendocrine convertase 1, also known as Prohormone convertase 1, Proprotein convertase 1, PCSK1 and NEC1, is an enzyme which belongs to the peptidase S8 family and Furin subfamily. PCSK1 is an enzyme that performs the proteolytic cleavage of prohormones to their intermediate (or sometimes completely cleaved) forms. It is present only in neuroendocrine cells such as brain, pituitary and adrenal, and most often cleaves after a pair of basic residues within prohormones but can occasionally cleave after a single arginine. It binds to a protein known as proSAAS, which also represents its endogenous inhibitor. PCSK1 is involved in the processing of hormone and other protein precursors at sites comprised of pairs of basic amino acid residues. PCSK1 substrates include POMC, renin, enkephalin, dynorphin, somatostatin and insulin. Defects in PCSK1 are the cause of proprotein convertase 1 deficiency (PC1 deficiency). PC1 deficiency is characterized by obesity, hypogonadism, hypoadrenalism, reactive hypoglycemia as well as marked small-intestinal absorptive dysfunction. It is due to impaired processing of prohormones.

  • Jackson RS. et al., 2003, J. Clin. Invest. 112:1550-60.
  • Farooqi I.S. et al., 2007, J. Clin. Endocrinol. Metab. 92: 3369-73.
  • Benzinou,M. et al., 2008,Nat Genet. 40 (8):943-5.
  • Benzinou M. et al., 2008, Nat. Genet. 40:943-5.
  • Renström F, et al., 2009, Hum. Mol. Genet. 18 (8): 1489-96.