Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL1A cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human IL1A Gene Plasmid Map
Human IL1F1 / IL1α Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman IL1RL2 / IL-1Rrp2 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL1F5 / IL36RN ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / DER4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL33 / Interleukin-33 / NF-HEV ProteinMouse IL-18R1 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human p38 alpha / MAPK14 Protein (His Tag)Mouse SIGIRR / TIR8 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL-1 beta / IL1B ProteinMouse IL18BP Protein (His Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human JNK2 / MAPK9 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL18R1 / CD218a Protein (His Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1R9 / IL1RAPL2 Protein (His Tag)Rat IL-1 beta / IL1B Protein (pro form, His Tag)Human SIGIRR / TIR8 Protein (His Tag)Rhesus IL-18 / IL-1F4 Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL1R1 / CD121a Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Mouse IL-1 beta / IL1B ProteinRat IL1R1 / CD121a Protein (His & Fc Tag)Human IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Mouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Rat IL-1 beta / IL1B Protein (mature form)Mouse IL1R1 / CD121a Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Feline IL1B / IL-1 beta ProteinCynomolgus IL-1 beta / IL1B ProteinHuman IL36B / IL1F8 ProteinHuman IL1F6 / IL36A ProteinMouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Canine IL-1 beta / IL1B ProteinHuman IL36G / IL1F9 ProteinMouse IL1F8 / IL36b ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinMouse IL1R1 / CD121a Protein (Fc Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinHuman IL36B / IL1F8 Protein (His Tag)Human IL1F6 / IL36A Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL36G / IL1F9 Protein (aa 18-169, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL36G / IL1F9 Protein (aa 18-169)Human IL1F6 / IL36 Protein (aa 6-158)Human p38 alpha / MAPK14 Protein (His Tag)Mouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rhesus IL18RAP Protein (Fc Tag)Rhesus IL18RAP Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Mouse IL18 / IL-18 ProteinHuman pro form of IL18 / Interleukin 18 / IGIF Protein (GST Tag)(Inactive)Human IL1R1 / CD121a ProteinHuman MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Mouse ERK2 / MAPK1 / MAPK2 ProteinHuman IL1R2 / IL1RB / CD121b ProteinMouse IL1RL1 / ST2 Protein (Fc Tag)Human SIGIRR / TIR8 Protein (Fc Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinMouse IL1RL1 / ST2 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.

  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
  • Images
    • Human IL1F1 / IL1α Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items