Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL1F9 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human IL1F9 Gene Plasmid Map
Human IL36G / IL1F9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman IL1RL2 / IL-1Rrp2 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL1F5 / IL36RN ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / DER4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL33 / Interleukin-33 / NF-HEV ProteinMouse IL-18R1 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human p38 alpha / MAPK14 Protein (His Tag)Mouse SIGIRR / TIR8 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL-1 beta / IL1B ProteinMouse IL18BP Protein (His Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human JNK2 / MAPK9 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL18R1 / CD218a Protein (His Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1R9 / IL1RAPL2 Protein (His Tag)Rat IL-1 beta / IL1B Protein (pro form, His Tag)Human SIGIRR / TIR8 Protein (His Tag)Rhesus IL-18 / IL-1F4 Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL1R1 / CD121a Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Mouse IL-1 beta / IL1B ProteinRat IL1R1 / CD121a Protein (His & Fc Tag)Human IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Mouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Rat IL-1 beta / IL1B Protein (mature form)Mouse IL1R1 / CD121a Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Feline IL1B / IL-1 beta ProteinCynomolgus IL-1 beta / IL1B ProteinHuman IL36B / IL1F8 ProteinHuman IL1F6 / IL36A ProteinMouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Canine IL-1 beta / IL1B ProteinHuman IL36G / IL1F9 ProteinMouse IL1F8 / IL36b ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinMouse IL1R1 / CD121a Protein (Fc Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinHuman IL36B / IL1F8 Protein (His Tag)Human IL1F6 / IL36A Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL36G / IL1F9 Protein (aa 18-169, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL36G / IL1F9 Protein (aa 18-169)Human IL1F6 / IL36 Protein (aa 6-158)Human p38 alpha / MAPK14 Protein (His Tag)Mouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rhesus IL18RAP Protein (Fc Tag)Rhesus IL18RAP Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Mouse IL18 / IL-18 ProteinHuman pro form of IL18 / Interleukin 18 / IGIF Protein (GST Tag)(Inactive)Human IL1R1 / CD121a ProteinHuman MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Mouse ERK2 / MAPK1 / MAPK2 ProteinHuman IL1R2 / IL1RB / CD121b ProteinMouse IL1RL1 / ST2 Protein (Fc Tag)Human SIGIRR / TIR8 Protein (Fc Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinMouse IL1RL1 / ST2 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Images
    • Human IL36G / IL1F9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.