After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL1F10 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL1F10 cDNA Clone Product Information
Gene_bank_ref_id:NM_032556.4
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 family, member 10 (theta), transcript variant 1.
Gene Synonym:IL1F10, FKSG75, IL-1HY2, IL1-theta, MGC119831, MGC119832, MGC119833, FIL1-theta
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-IL1F10
Restriction Site:KpnI + XhoI (5.5kb + 0.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 72T/C,152C/A , neither of which results in the variation of encoded amino acids.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1F10 Gene Plasmid Map
Human IL1F10 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10122-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"