Quick Order

Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EBI3cDNA Clone Product Information
cDNA Size:690
cDNA Description:ORF Clone of Homo sapiens Epstein-Barr virus induced 3 (EBI3) DNA.
Gene Synonym:IL27B, EBI3
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
IL-12 Family & Receptor Related Products
Product nameProduct name
Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12B / P40 Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL27 / Interleukin-27 Protein (His Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12RB1 / IL12RB / CD212 Protein (His Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL12B / IL-12B Protein (Fc Tag)Mouse IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinCynomolgus / Rhesus IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL27 / Interleukin-27 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Cynomolgus / Rhesus IL12A / NKSF1 Protein (Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag) Cynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Marmoset IL12B / IL-12B Protein (Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL12A & IL27B Heterodimer Protein

The novel Ebi3-IL-12alpha heterodimeric cytokine has been designated interleukin-35 (IL-35), is a member IL12 family cytokine produced by regulatory T cells (Treg), but not by resting or activated effector T cells (Teff). IL-35 is a heterodimeric protein composed of IL-12α (P35) and IL-27β chains, which are encoded by two separate genes called IL12A and EBI3 (Epstein-Barr-virus-induced gene 3) respectively. Ectopic expression of IL-35 confers regulatory activity on naive T cells, whereas recombinant IL-35 suppresses T-cell proliferation. It identify IL-35 as a novel inhibitory cytokine that may be specifically produced by T(reg) cells and is required for maximal suppressive activity. IL-35 has biological activity and able to expand CD4+CD25+ Treg cells, suppress the proliferation of CD4+CD25- effector cells and inhibit Th17 cell polarization. IL-35 has been shown to be constitutively expressed by regulatory T (Treg) cells CD4(+)CD25(+)Foxp3(+) and suggested to contribute to their suppressive activity. IL-35 is a crucial mediator which provokes CD4+CD25+ T cell proliferation and IL-10 generation, another well-known anti-inflammatory cytokine, along with TGFbeta cytokine. IL-35 is a cytokine can downregulate Th17 cell development and inhibit autoimmune inflammation. It inhibited the differentiation of Th17 cells in vitro. In vivo, IL-35 effectively attenuated established collagen-induced arthritis in mice, with concomitant suppression of IL-17 production but enhanced IFN-gamma synthesis. Thus, IL-35 is a novel anti-inflammatory cytokine suppressing the immune response through the expansion of regulatory T cells and suppression of Th17 cell development.

  • Niedbala W, et al. (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37(11): 3021-9.
  • Collison LW, et al. (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 450(7169): 566-9.
  • Castellani ML, et al. (2010) IL-35, an anti-inflammatory cytokine which expands CD4+CD25+ Treg Cells. J Biol Regul Homeost Agents. 24(2): 131-5.
  • Kochetkova I, et al. (2010) IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol. 184(12): 7144-53.
  • Seyerl M, et al. (2010) Human rhinoviruses induce IL-35-producing Treg via induction of B7-H1 (CD274) and sialoadhesin (CD169) on DC. Eur J Immunol. 40(2): 321-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human EBI3 / IL27b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged