Quick Order

Human EBI3 / IL27b ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human EBI3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human IL-12 Protein (IL12A & IL12B Heterodimer) Protein (His Tag)Rat IL23R / IL23 Receptor Protein (ECD, His Tag)Rabbit IL12B / IL-12B Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Human IL-23 (IL12B & IL23A Heterodimer) Protein (His Tag)Rat IL12B / IL-12B Protein (Fc Tag)Human IL23A & Mouse IL12B Heterodimer Protein (His Tag)Human IL12A / NKSF1 Protein (Fc Tag)Human IL12B / P40 Protein (Fc Tag)Human IL27Ra / TCCR / WSX1 Protein (Fc Tag)Human IL-35 (IL12A & IL27B) Protein (Fc Tag)Human IL12B / P40 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Human IL12A / NKSF1 Protein (His Tag)Human IL12RB1 / IL12RB / CD212 Protein (His Tag)Mouse IL12RB2 / IL12R-beta 2 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Human IL-12 (IL12A & IL12B Heterodimer) ProteinHuman IL-23 (IL23A & IL12B Heterodimer) ProteinRat gp130 / IL6ST / CD130 Protein (His Tag)Mouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL-12 (IL12A & IL12B Heterodimer) ProteinMouse IL12B / IL-12B Protein (Fc Tag)Rat IL-23 (IL23A & IL12B Heterodimer) ProteinMouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Cynomolgus / Rhesus IL23R / IL23 Receptor Protein (Fc Tag)Human IL27 / Interleukin-27 Protein (His Tag)Mouse IL27 / Interleukin-27 Protein (His Tag)Mouse IL12B / IL-12B Protein (His Tag)Rat IL23R / IL23 Receptor Protein (Fc Tag)Human IL23R / IL23 Receptor Protein (Fc Tag)Rat IL12B / IL-12B Protein (His Tag)Mouse IL12B / IL-12B ProteinMouse IL-23 (IL23A & IL12B Heterodimer) ProteinMarmoset IL12B / IL-12B Protein (Fc Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Marmoset IL-23 (IL23A & IL12B Heterodimer) ProteinRhesus IL-12 (IL12A & IL12B Heterodimer) ProteinRhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman IL12A & IL27B Heterodimer ProteinRhesus IL12A / NKSF1 Protein (Fc Tag)

The novel Ebi3-IL-12alpha heterodimeric cytokine has been designated interleukin-35 (IL-35), is a member IL12 family cytokine produced by regulatory T cells (Treg), but not by resting or activated effector T cells (Teff). IL-35 is a heterodimeric protein composed of IL-12α (P35) and IL-27β chains, which are encoded by two separate genes called IL12A and EBI3 (Epstein-Barr-virus-induced gene 3) respectively. Ectopic expression of IL-35 confers regulatory activity on naive T cells, whereas recombinant IL-35 suppresses T-cell proliferation. It identify IL-35 as a novel inhibitory cytokine that may be specifically produced by T(reg) cells and is required for maximal suppressive activity. IL-35 has biological activity and able to expand CD4+CD25+ Treg cells, suppress the proliferation of CD4+CD25- effector cells and inhibit Th17 cell polarization. IL-35 has been shown to be constitutively expressed by regulatory T (Treg) cells CD4(+)CD25(+)Foxp3(+) and suggested to contribute to their suppressive activity. IL-35 is a crucial mediator which provokes CD4+CD25+ T cell proliferation and IL-10 generation, another well-known anti-inflammatory cytokine, along with TGFbeta cytokine. IL-35 is a cytokine can downregulate Th17 cell development and inhibit autoimmune inflammation. It inhibited the differentiation of Th17 cells in vitro. In vivo, IL-35 effectively attenuated established collagen-induced arthritis in mice, with concomitant suppression of IL-17 production but enhanced IFN-gamma synthesis. Thus, IL-35 is a novel anti-inflammatory cytokine suppressing the immune response through the expansion of regulatory T cells and suppression of Th17 cell development.

  • Niedbala W, et al. (2007) IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37(11): 3021-9.
  • Collison LW, et al. (2007) The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 450(7169): 566-9.
  • Castellani ML, et al. (2010) IL-35, an anti-inflammatory cytokine which expands CD4+CD25+ Treg Cells. J Biol Regul Homeost Agents. 24(2): 131-5.
  • Kochetkova I, et al. (2010) IL-35 stimulation of CD39+ regulatory T cells confers protection against collagen II-induced arthritis via the production of IL-10. J Immunol. 184(12): 7144-53.
  • Seyerl M, et al. (2010) Human rhinoviruses induce IL-35-producing Treg via induction of B7-H1 (CD274) and sialoadhesin (CD169) on DC. Eur J Immunol. 40(2): 321-9.