Quick Order

DatasheetReviewsRelated ProductsProtocols
Human DUSP3/VHR cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human DUSP3/VHR Gene Plasmid Map
Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Vaccinia H1-related phosphatase (VHR) is classified as a dual-specificity phosphatase (DUSP), and the other name is dual-specificity phosphatase 3 (DUSP3). DUSPs are a heterogeneous group of protein phosphatases that can dephosphorylate both phosphotyrosine and phosphoserine/phosphothreonine residues within the one substrate. Unlike typical DUSPs, VHR lacks mitogen-activated protein kinase (MAPK)-binding domain, and shows poor activity against MAPKs. VHR often act on bisphosphorylated protein substrates, it displays a strong preference for dephosphorylating phosphotyrosine residues over phosphothreonine residues. VHR has been identified as a novel regulator of extracellular regulated kinases (ERKs). VHR is responsible for the rapid inactivation of ERK following stimulation and for its repression in quiescent cells. VHR is a negative regulator of the Erk and Jnk pathways in T cells and, therefore, may play a role in aspects of T lymphocyte physiology that depend on these kinases.

  • Todd J.L, et al. (1999) Extracellular regulated kinases (ERK) 1 and ERK2 are authentic substrates for the dual-specificity protein-tyrosine phosphatase VHR. A novel role in down-regulating the ERK pathway. J. Biol. Chem. 274: 13271-80.
  • Alonso A, et al. (2001) Inhibitory role for dual specificity phosphatase VHR in T cell antigen receptor and CD28-induced Erk and Jnk activation. J Biol Chem. 276(7): 4766-71.
  • Schumacher MA, et al. (2002) Structural basis for the recognition of a bisphosphorylated MAP kinase peptide by human VHR protein Phosphatase. Biochemistry. 41(9): 3009-17.
  • Patterson KI, et al. (2009) Dual-specificity phosphatases: critical regulators with diverse cellular targets. Biochem J. 2009 Mar 15;418(3): 475-89.
  • Images
    • Human VHR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.