Quick Order

Human ACE2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACE2 cDNA Clone Product Information
RefSeq ORF Size:2418bp
cDNA Description:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with Flag tag.
Gene Synonym:ACE2, ACEH, DKFZP434A014
Restriction Site:KpnI + XhoI (5.5kb + 2.45kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ACE2 Gene Plasmid Map
Human ACE2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human ACE2 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human ACE2 natural ORF mammalian expression plasmid, Flag tag
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.