After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL1RL1/ST2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human IL1RL1/ST2 Gene Plasmid Map
Human IL1RL1 / ST2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human IL18 / IL-18 ProteinCanine IL18R1 Protein (ECD, His Tag)Human IL1RL2 / IL-1Rrp2 Protein (Fc Tag)Cynomolgus IL18R1 Protein (His Tag)Mouse IL18RAP / IL1R7 Protein (His Tag)Sus scrofa (Pig) IL1B / IL-1 beta ProteinHuman IL1RL2 / IL-1Rrp2 Protein (His Tag)Human IL18BPa Protein (His & Fc Tag)Human IL18BPa Protein (His Tag)Human IL1F5 / IL36RN ProteinHuman IL1R2 / CD121b Protein (Fc Tag)Human IL1RL1 / DER4 Protein (Fc Tag)Human IL1RL1 / DER4 ProteinHuman IL-1R9 / IL1RAPL2 Protein (Fc Tag)Human IL-1RA / IL1RN Protein (Fc Tag)Human IL-1RA / IL1RN ProteinHuman IL-1 alpha / IL1A / IL1F1 ProteinHuman IL33 / Interleukin-33 / NF-HEV ProteinMouse IL-18R1 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (Fc Tag)Human p38 alpha / MAPK14 Protein (His Tag)Mouse SIGIRR / TIR8 Protein (His & Fc Tag)Human IL-1R8 / IL1RAPL1 Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His & Fc Tag)Human IL1R1 / CD121a Protein (Fc Tag)Human IL1R1 / CD121a Protein (His Tag)Human IL-1 beta / IL1B ProteinMouse IL18BP Protein (His Tag)Human JNK1 / MAPK8 Protein (GST Tag)Human JNK2 / MAPK9 Protein (His Tag)Human IL18RAP / IL1R7 Protein (Fc Tag)Human IL18R1 / CD218a Protein (His Tag)Human IL-1RAcP / IL-1R3 Protein (His Tag)Human IL18R1 / CD218a Protein (His & Fc Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human IL1RL1 / ST2 Protein (His Tag)Human IL1R2 / IL1RB / CD121b Protein (His Tag)Mouse IL18R1 / CD218a Protein (His Tag)Human IL18RAP / IL1R7 Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Mouse IL-1 alpha / IL1A / IL1F1 ProteinHuman IL-1R9 / IL1RAPL2 Protein (His Tag)Rat IL-1 beta / IL1B Protein (pro form, His Tag)Human SIGIRR / TIR8 Protein (His Tag)Rhesus IL-18 / IL-1F4 Protein (His Tag)Mouse IL-1F6 / IL-1 epsilon ProteinHuman IL-1 beta / IL1B Protein (pro form, His Tag)Rat IL1R1 / CD121a Protein (His Tag)Human MARK3 / CTAK1 / EMK-2 Protein (His & GST Tag)Mouse IL-1 beta / IL1B ProteinRat IL1R1 / CD121a Protein (His & Fc Tag)Human IL1RL1 / ST2 Protein (isoform a, His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Human MKK6 / MEK6 / MAP2K6 Protein (His & GST Tag)Mouse MKK4 / MEK4 / MAP2K4 Protein (His & GST Tag)Rat IL-1 beta / IL1B Protein (mature form)Mouse IL1R1 / CD121a Protein (His Tag)Human RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Feline IL1B / IL-1 beta ProteinCynomolgus IL-1 beta / IL1B ProteinHuman IL36B / IL1F8 ProteinHuman IL1F6 / IL36A ProteinMouse IL-1R8 / IL1RAPL1 Protein (Fc Tag)Canine IL-1 beta / IL1B ProteinHuman IL36G / IL1F9 ProteinMouse IL1F8 / IL36b ProteinHuman IL37 / IL1F7 / IL-1H4 ProteinMouse IL1R1 / CD121a Protein (Fc Tag)Human MKK6 / MEK6 / MAP2K6 Protein (207 Ser/Asp, 211 Thr/Asp, His & GST Tag)Canine IL33 / Interleukin-33 / NF-HEV ProteinHuman IL36B / IL1F8 Protein (His Tag)Human IL1F6 / IL36A Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Rat IL18R1 Protein (Fc Tag)Rat IL1R2 / IL1RB / CD121b Protein (His Tag)Human IL36G / IL1F9 Protein (aa 18-169, His Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Human IL36G / IL1F9 Protein (aa 18-169)Human IL1F6 / IL36 Protein (aa 6-158)Human p38 alpha / MAPK14 Protein (His Tag)Mouse IL1R2 / CD121b Protein (Fc Tag)Mouse IL1R2 / CD121b Protein (His Tag)Rat IL-1RA / IL1RN Protein (Fc Tag)Rhesus IL18RAP Protein (Fc Tag)Rhesus IL18RAP Protein (His Tag)Cynomolgus IL1R2 / IL1RB Protein (Fc Tag)Mouse IL18 / IL-18 ProteinHuman pro form of IL18 / Interleukin 18 / IGIF Protein (GST Tag)(Inactive)Human IL1R1 / CD121a ProteinHuman MKK6 / MEK6 / MAP2K6 ProteinHuman MKK6 / MEK6 / MAP2K6 Protein (207 Asp, 211 Asp)Mouse ERK2 / MAPK1 / MAPK2 ProteinHuman IL1R2 / IL1RB / CD121b ProteinMouse IL1RL1 / ST2 Protein (Fc Tag)Human SIGIRR / TIR8 Protein (Fc Tag)Cynomolgus IL1R1 Protein (Fc Tag)Cynomolgus IL1R1 Protein (His Tag)Canine IL18R1 Protein (Fc Tag)Canine IL1R2 / IL1RB Protein (Fc Tag)Rat IL18R1 Protein (His Tag)Mouse IL36G / IL1F9 Protein (His Tag)Cynomolgus IL18R1 Protein (Fc Tag)Rabbit IL-1 beta / IL1B ProteinMouse IL1RL1 / ST2 Protein (His Tag)Human IL1F10 / IL-38 Protein (His Tag)
Background

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

References
  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • Images
    • Human IL1RL1 / ST2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"