After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ITKcDNA Clone Product Information
cDNA Size:1863
cDNA Description:ORF Clone of Homo sapiens IL2-inducible T-cell kinase DNA.
Gene Synonym:ITK, EMT, LYK, PSCTK2, MGC126257, MGC126258
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10104-ACG$345
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10104-ACR$345
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10104-ANG$345
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10104-ANR$345
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10104-CF$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10104-CH$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10104-CM$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10104-CY$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone)HG10104-M$115
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10104-M-N$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10104-NF$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10104-NH$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10104-NM$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10104-NY$315
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10104-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged