After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RPS6KB1cDNA Clone Product Information
cDNA Size:1578
cDNA Description:ORF Clone of Homo sapiens ribosomal protein S6 kinase, 70kDa, polypeptide 1 DNA.
Gene Synonym:RPS6KB1, S6K, PS6K, S6K1, STK14A, p70-S6K, p70-alpha, p70(S6K)-alpha
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10099-ACG$345
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10099-ACR$345
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10099-ANG$345
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10099-ANR$345
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10099-CF$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10099-CH$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10099-CM$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10099-CY$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone)HG10099-M$115
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10099-M-F$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10099-NF$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10099-NH$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10099-NM$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10099-NY$315
Human S6K / RPS6KB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10099-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.