Quick Order

Text Size:AAA

Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PXNcDNA Clone Product Information
cDNA Size:1674
cDNA Description:ORF Clone of Homo sapiens paxillin, transcript variant 1 DNA.
Gene Synonym:PXN, FLJ16691
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10095-ACG$345
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10095-ACR$345
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10095-ANG$345
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10095-ANR$345
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10095-CF$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10095-CH$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10095-CM$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10095-CY$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG10095-M$115
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10095-M-F$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10095-NF$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10095-NH$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10095-NM$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10095-NY$315
Human paxillin transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10095-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name