Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GAPDH cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human GAPDH Gene Plasmid Map
Human GAPDH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

References
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Images
    • Human GAPDH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"