After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKT1S1/PRAS40 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human AKT1S1/PRAS40 Gene Plasmid Map
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-GFPSpark tagHG10092-ACG$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10092-ACR$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-GFPSpark tagHG10092-ANG$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10092-ANR$325
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-Flag tagHG10092-CF$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-His tagHG10092-CH$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-Myc tagHG10092-CM$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, C-HA tagHG10092-CY$295
Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA clone plasmidHG10092-M$195
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, Flag tagHG10092-M-F$395
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-Flag tagHG10092-NF$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-His tagHG10092-NH$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-Myc tagHG10092-NM$295
Human AKT1S1 / PRAS40 transcript variant 2 ORF mammalian expression plasmid, N-HA tagHG10092-NY$295
Human AKT1S1 / PRAS40 transcript variant 2 natural ORF mammalian expression plasmidHG10092-UT$295
 Learn more about expression Vectors
Product nameProduct name
  • Human AKT1S1 / PRAS40 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items