Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human GPC3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Glypican-3, also known as Intestinal protein OCI-5, GPC3, and OCI5, is a member of the glypican family. It belongs to the glypican family and is highly expressed in lung, liver, and kidney. It is a heparan sulfate proteoglycan, which is overexpressed in various neoplasms such as hepatocellular carcinoma, malignant melanoma, and testicular yolk sac tumor, and plays an important role in cell growth and differentiation. GPC3 function is tissue dependent. In some tissues, GPC3 acts as a tumor suppressor gene, whereas in others, it acts as an oncofetal protein. Studies have shown that GPC3 is a reliable marker for hepatocellular carcinoma. The sensitivity and specificity exceeds both alpha-fetoprotein and hepatocyte-paraffin1. GPC3 immunohistochemistry can aid in the differentiation of testicular germ cell tumors, being expressed in all yolk sac tumors but not in seminomas. GPC3 expression has also been identified in some squamous cell carcinomas of the lung and clear cell carcinomas of the ovary. The role of GPC3 in melanomas is still controversial. Thus, Glypican-3 is currently regarded as a tumor marker and potential target for immunotherapy.

  • Kandil DH, et al. (2009) Glypican-3: a novel diagnostic marker for hepatocellular carcinoma and more. Adv Anat Pathol. 16(2): 125-9.
  • Maeda D, et al. (2009) Glypican-3 expression in clear cell adenocarcinoma of the ovary. Mod Pathol. 22(6): 824-32.
  • Images
    • Human glypican 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items