Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD45/PTPRC cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Images
    • Human CD45 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items