After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PKRcDNA Clone Product Information
cDNA Size:1656
cDNA Description:ORF Clone of Homo sapiens eukaryotic translation initiation factor 2-alpha, kinase 2 DNA.
Gene Synonym:EIF2AK2, PKR, PRKR, EIF2AK1, MGC126524
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10080-ACG$345
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10080-ACR$345
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10080-ANG$345
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10080-ANR$345
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10080-CF$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10080-CH$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10080-CM$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10080-CY$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone)HG10080-M$115
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10080-M-F$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, HA-taggedHG10080-M-Y$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10080-NF$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10080-NH$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10080-NM$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10080-NY$315
Human EIF2AK2 / PKR Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10080-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name