Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Glypican 5 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human Glypican 5 Gene Plasmid Map
Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Glypican-5 (GPC5), is a cell membrane protein which belongs to the glypican family. The glypicans compose a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans that may play a role in the control of cell division and growth regulation. So far, six members (Glypican-1/GPC1, Glypican-2/GPC2, Glypican-3/GPC3, Glypican-4/GPC4, Glypican-5/GPC5, Glypican-6/GPC6) of this family are known in vertebrates. In adult, Glypican-5 is primarily expressed in the brain. It is also detected in fetal brain, lung and liver. Glypican-5 enhances the intracellular signaling of FGF2 and HGF. It alters the cellular distribution of FGF2. The properties of Glypican-5 make it an attractive target for therapeutic intervention in rhabdomyosarcomas and other tumors that amplify and/or overexpress its gene. Glypican-5 is over-expressed in lymphoma cell lines that had shown amplification. It is a likely target for amplification, and that over-expression of GPC5 may contribute to development and/or progression of lymphomas and other tumors.

  • Yu W, et al. (2003) GPC5 is a possible target for the 13q31-q32 amplification detected in lymphoma cell lines. J Hum Genet. 48(6): 331-5.
  • Williamson D, et al. (2007) Role for amplification and expression of glypican-5 in rhabdomyosarcoma. Cancer Res. 67(1): 57-65.
  • Images
    • Human GPC5 / glypican 5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items