After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AGRP cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human AGRP Gene Plasmid Map
Human AGRP transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.

  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • Images
    • Human AGRP transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items