Quick Order

Text Size:AAA

Human BACE1 / ASP2 transcript variant a ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BACE1 cDNA Clone Product Information
NCBI RefSeq:AF190725
RefSeq ORF Size:1506bp
cDNA Description:Full length Clone DNA of Homo sapiens beta-site APP-cleaving enzyme 1 (BACE1), transcript variant a with His tag.
Gene Synonym:BACE1, ASP2, BACE, HSPC104, FLJ90568, KIAA1149
Restriction Site:HindIII + XhoI (5.5kb + 1.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BACE1 Gene Plasmid Map
Human BACE1 / ASP2 transcript variant a Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Beta-site APP-cleaving enzyme 1 (BACE1) is an aspartic-acid protease important in the formation of myelin sheaths in peripheral nerve cells. In the brain, This protein is expressed highly in the substantia nigra, locus coruleus and medulla oblongata. Strong BACE1 expression has also been described in pancreatic tissue. BACE1 has a pivotal role in the pathogenesis of Alzheimer's disease. In Alzheimer's disease patients, BACE1 levels were elevated although mRNA levels were not changed. It has been found that BACE1 gene expression is controlled by a TATA-less promoter. The translational repression as a new mechanism controlling its expression. And the low concentrations of Ca(2+) (microM range) significantly increased the proteolytic activity of BACE1. Furthermore, BACE1 protein is ubiquitinated, and the degradation of BACE1 proteins and amyloid precursor protein processing are regulated by the ubiquitin-proteasome pathway. It has also been identified as the rate limiting enzyme for amyloid-beta-peptide (Abeta) production.

  • Christensen MA, et al. (2004) Transcriptional regulation of BACE1, the beta-amyloid precursor protein beta-secretase, by Sp1. Mol Cell Biol. 24(2):865-74.
  • Stockley JH, et al. (2007) The proteins BACE1 and BACE2 and beta-secretase activity in normal and Alzheimer's disease brain. Biochem Soc Trans. 35(Pt 3): 574-6.
  • Savonenko AV, et al. (2008) Alteration of BACE1-dependent NRG1/ErbB4 signaling and schizophrenia-like phenotypes in BACE1-null mice. Proc Natl Acad Sci U S A. 105(14): 5585-90.
  • Hayley M, et al. (2009) Calcium enhances the proteolytic activity of BACE1: An in vitro biophysical and biochemical characterization of the BACE1-calcium interaction. Biochim Biophys Acta. 1788(9): 1933-8.
  • Size / Price
    Catalog: HG10064-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.