Quick Order

Human CA VIII natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CA8 cDNA Clone Product Information
Gene_bank_ref_id:NM_004056.4
RefSeq ORF Size:873bp
cDNA Description:Full length Clone DNA of Homo sapiens carbonic anhydrase VIII.
Gene Synonym:CA8, CALS, CARP, CA-VIII
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-CA8
Restriction Site:KpnI + XhoI (5.5kb + 0.87kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 327 A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase protein (CA) VIII, which is a member of the CA gene family, has been shown to have no catalytic CA activity and its biological function is still unknown. Increased expression of CA-RP VIII was observed in 78% of colorectal carcinomas. It suggested that CA-RP VIII plays a role in the process of invasion in colorectal cancer.

References
  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Miyaji E, et al. (2003) Overexpression of carbonic anhydrase-related protein VIII in human colorectal cancer. The Journal of Pathology. 201(1): 37-45.
  • Size / Price
    Catalog: HG10063-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"