Quick Order

Human CDC42 transcript variant 3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDC42 cDNA Clone Product Information
RefSeq ORF Size:576bp
cDNA Description:ORF Clone of Homo sapiens cell division cycle 42 (GTP binding protein, 25kDa), transcript variant 3 DNA.
Gene Synonym:CDC42, G25K, CDC42Hs
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
et al.
  • Shinjo K, et al. (1990) Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci. 87(24):9853-7.
  • Munemitsu S, et al. (1990) Molecular cloning and expression of a G25K cDNA, the human homolog of the yeast cell cycle gene CDC42. Mol Cell Biol. 10(11):5977-82.
  • Walker S J, et al. (2000) Activation of phospholipase D1 by Cdc42 requires the Rho insert region. J Biol Chem. 275(21):15665-8.
  • Low B C, et al. (1999) Tyrosine phosphorylation of the Bcl-2-associated protein BNIP-2 by fibroblast growth factor receptor-1 prevents its binding to Cdc42GAP and Cdc42. J Biol Chem. 274(46): 33123-30.
  • Zhang B, et al. (1998) Interaction of Rac1 with GTPase-activating proteins and putative effectors. A comparison with Cdc42 and RhoA. J Biol Chem. 273(15):8776-82.
  • Size / Price
    Catalog: HG10062-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions