After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD282 / TLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD282/TLR2cDNA Clone Product Information
cDNA Size:2355
cDNA Description:ORF Clone of Homo sapiens toll-like receptor 2 DNA.
Gene Synonym:TLR2, TIL4, CD282
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

TLR2, also known as CD282, is a member of the Toll-like receptor (TLR) family. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They play a fundamental role in pathogen recognition and activation of innate immunity. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. TLR2 contains 14 LRR (leucine-rich) repeats and 1 TIR domain. TLR2 gene is expressed most abundantly in peripheral blood leukocytes, and mediates host response to Gram-positive bacteria and yeast via stimulation of NF-kappaB. CD282 cooperates with LY96 to mediate the innate immune response to bacterial lipoproteins and other microbial cell wall components. It also cooperates with TLR1 to mediate the innate immune response to bacterial lipoproteins or lipopeptides. CD282 acts via MYD88 and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It may also promote apoptosis in response to lipoproteins.

  • Do KN, et al. (2012) TLR2 controls intestinal carcinogen detoxication by CYP1A1. PLoS ONE. 7 (3): e32309.
  • Dziarski R, et al. (2001) Role of MD-2 in TLR2- and TLR4-mediated recognition of Gram-negative and Gram-positive bacteria and activation of chemokine genes. J Endotoxin Res. 6 (5): 401-5.
  • Lorenz E, (2007) TLR2 and TLR4 expression during bacterial infections. Curr Pharm Des. 12 (32): 4185-93.
  • Size / Price
    List Price: $345.00  (Save $30.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human CD282 / TLR2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items